Java 2 | Computer Science homework help

One of the key features of Java OOP is to use external class files without knowing much of the implementations. The attached RandomSeq.class file contains the implementation of a RandomSeq class which contain two methods:

    String RandomSeq.getRandomSeq(long arg0) -will return a String of randomly generated DNA sequence of any length passed in as a parameter, and
    void RandomSeq.formatSeq(int arg0) – will print out a formatted DNA sequence with specified length for each line as shown below:

 

   1 GACTTGCCAGTTTAATAATGTCACATAATCAGATACGTAGATTCGCTTAT

  51 ATGCCCGGCCCACTGACGGAGGGGCCCGGGGGTCCAGCCCATGGGGCAGA

 101 GGGACACTCTGAACGCTCGCGCAGGTACGTGTGGTAAACCGATATCGCGC

 151 TTCTACTGACTCTCCCACTCAACGAAGACAAGACTTTGGCCACTCACCCG

 201 GCATTACTATAGCTCGGTGCAGGGAGTCCTCAGCCCCGCGATGGATATTA

 251 GGCTGGCCCCTAACCTGCGAGGACATTCAAAGTAGGTTTTGACCGGCATT

 301 GCAAGGTCACTGAGGAGAATTTATGATAGCCGCCCATACC

The RandomSeq class also has two properties (id and seq) which has the set/get methods of setSeqID(String arg0), setSeq(String arg0), and getSeqID(), getSeq().

Please note, when a DNA sequence String was generated using the getRandomSeq() method, the sequence need to be assigned to the object using the setSeq(String arg0) method. After that, the formatSeq() method can be used to print out the formatted sequence.

Please create a testing Java program to use this RandomSeq class to create a random DNA sequence and then print it out in a formatted fashion with a specified length for each line.
Note: if you use NotePad to create your project, you can simply copy the RandomSeq.class attached file into the same folder of your testing Java program. If you use Eclipse or NetBeans, you probably need to create an external class folder for your project and then import the RandomSeq.class file into the class folder.

Here is how to add the RandomSeq.class file to your project in NetBeans and Eclipse: (assume the RandomSeq.class file is saved into C:BIFS618)

NetBeans: Create the project first, and then right click on the Libraries from the Projects window, and select Add JAR/Folder to open the window. Browse to the folder contains the .class file (c:BIFS618), click open. Now the folder is added to the Libraries, and you can create a RandomSeq object directly in your project.

Eclipse: Create the project first, and then right click on the project to select properties. In the properties window, select Libraries tab, and click on Add External Class Folder to select the folder contains the RandomSeq class file and click OK. Now you can use the RandomSeq class directly in your project.

Semester Papers
Calculate your paper price
Pages (550 words)
Approximate price: -

Why Work with Us

Top Quality and Well-Researched Papers

We always make sure that writers follow all your instructions precisely. You can choose your academic level: high school, college/university or professional, and we will assign a writer who has a respective degree.

Professional and Experienced Academic Writers

We have a team of professional writers with experience in academic and business writing. Many are native speakers and able to perform any task for which you need help.

Free Unlimited Revisions

If you think we missed something, send your order for a free revision. You have 10 days to submit the order for review after you have received the final document. You can do this yourself after logging into your personal account or by contacting our support.

Prompt Delivery and 100% Money-Back-Guarantee

All papers are always delivered on time. In case we need more time to master your paper, we may contact you regarding the deadline extension. In case you cannot provide us with more time, a 100% refund is guaranteed.

Original & Confidential

We use several writing tools checks to ensure that all documents you receive are free from plagiarism. Our editors carefully review all quotations in the text. We also promise maximum confidentiality in all of our services.

24/7 Customer Support

Our support agents are available 24 hours a day 7 days a week and committed to providing you with the best customer experience. Get in touch whenever you need any assistance.

Try it now!

Calculate the price of your order

Total price:
$0.00

How it works?

Follow these simple steps to get your paper done

Place your order

Fill in the order form and provide all details of your assignment.

Proceed with the payment

Choose the payment system that suits you most.

Receive the final file

Once your paper is ready, we will email it to you.

Our Services

No need to work on your paper at night. Sleep tight, we will cover your back. We offer all kinds of writing services.

Essays

Essay Writing Service

No matter what kind of academic paper you need and how urgent you need it, you are welcome to choose your academic level and the type of your paper at an affordable price. We take care of all your paper needs and give a 24/7 customer care support system.

Admissions

Admission Essays & Business Writing Help

An admission essay is an essay or other written statement by a candidate, often a potential student enrolling in a college, university, or graduate school. You can be rest assurred that through our service we will write the best admission essay for you.

Reviews

Editing Support

Our academic writers and editors make the necessary changes to your paper so that it is polished. We also format your document by correctly quoting the sources and creating reference lists in the formats APA, Harvard, MLA, Chicago / Turabian.

Reviews

Revision Support

If you think your paper could be improved, you can request a review. In this case, your paper will be checked by the writer or assigned to an editor. You can use this option as many times as you see fit. This is free because we want you to be completely satisfied with the service offered.